Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 80410
End position: 80453
Length: 44

DNA sequence
>NC_015588, from 80410 to 80453 (44 bp); Isoptericola variabilis 225 GCCGGTCAGCCGCCCGTCAGCTGCCCGTCAGTCGCCGGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 80438-81046	Sequence	Isova_0075 - DNA-3-methyladenine glycosylase I (Protein is coded in complementary strand; from 81046 to 80438)