Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 815567
End position: 815626
Length: 60

DNA sequence
>NC_015588, from 815567 to 815626 (60 bp); Isoptericola variabilis 225 TTCCAGCGCTACCTCGGCGGATCGAGCGCTACCTCGGCGGATCGAGCGCTACCTCGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 815616-816926	Sequence	Isova_0767 - ferredoxin--NAD(+) reductase (Protein is coded in complementary strand; from 816926 to 815616)