Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 835307
End position: 835342
Length: 36

DNA sequence
>NC_015588, from 835307 to 835342 (36 bp); Isoptericola variabilis 225 ACGACGAGCTCGACGTCGAGCTCGTCGACGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 834956-835861	Sequence	Isova_0781 - formyltetrahydrofolate deformylase (Protein is coded in complementary strand; from 835861 to 834956)