Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 848648
End position: 848671
Length: 24

DNA sequence
>NC_015588, from 848648 to 848671 (24 bp); Isoptericola variabilis 225 GAGCACGAGCGCGAGCCCGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 848247-849140	Sequence	Isova_0789 - ABC transporter (Protein is coded in complementary strand; from 849140 to 848247)