Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 862630
End position: 862659
Length: 30

DNA sequence
>NC_015588, from 862630 to 862659 (30 bp); Isoptericola variabilis 225 CGCGAGCGCCAGCGCGAGCGAGAGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 862025-863005	Sequence	Isova_0800 - ABC transporter (Protein is coded in complementary strand; from 863005 to 862025)