Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 1117819
End position: 1117845
Length: 27

DNA sequence
>NC_015589, from 1117819 to 1117845 (27 bp); Desulfotomaculum ruminis DSM 2154 AAAGTTGCCAAGGTTGCCGAAGTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1115357-1117819	Sequence	Desru_1082 - virulence-associated E family protein