Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 1485531
End position: 1485584
Length: 54

DNA sequence
>NC_015589, from 1485531 to 1485584 (54 bp); Desulfotomaculum ruminis DSM 2154 GAATTAACTACCGATGAAGAAACAACCACCGATGAAGAAATAGCTACAGATGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1485091-1485678	Sequence	Desru_1456 - copper amine oxidase-like domain-containing protein