Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 2326779
End position: 2326802
Length: 24

DNA sequence
>NC_015589, from 2326779 to 2326802 (24 bp); Desulfotomaculum ruminis DSM 2154 CCAGGATCAGGACCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2325902-2327773	Sequence	Desru_2304 - Serine/threonine-protein kinase-like domain-containing protein (Protein is coded in complementary strand; from 2327773 to 2325902)