Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 2695747
End position: 2695770
Length: 24

DNA sequence
>NC_015589, from 2695747 to 2695770 (24 bp); Desulfotomaculum ruminis DSM 2154 TCCGGGCCGCCGGGCCGCCGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2692756-2696499	Sequence	Desru_2637 - recombination helicase AddA (Protein is coded in complementary strand; from 2696499 to 2692756)