Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 2755560
End position: 2755583
Length: 24

DNA sequence
>NC_015589, from 2755560 to 2755583 (24 bp); Desulfotomaculum ruminis DSM 2154 ATGATGATGATGGTGATGGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2755540-2755926	Sequence	Desru_2683 - dinitrogenase iron-molybdenum cofactor biosynthesis protein (Protein is coded in complementary strand; from 2755926 to 2755540)