Sequence retrieval

Genome: Desulfotomaculum ruminis DSM 2154
Start position: 3265829
End position: 3265858
Length: 30

DNA sequence
>NC_015589, from 3265829 to 3265858 (30 bp); Desulfotomaculum ruminis DSM 2154 ATGATTTTTTTTGATTTTATTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3265589-3266389	Sequence	Desru_3207 - hypothetical protein (Protein is coded in complementary strand; from 3266389 to 3265589)