Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1028638
End position: 1028661
Length: 24

DNA sequence
>NC_015671, from 1028638 to 1028661 (24 bp); Cellvibrio gilvus ATCC 13127 CGGCGGCGGTGGCGGCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1026917-1028857	Sequence	Celgi_0939 - glycosyl transferase 2 (Protein is coded in complementary strand; from 1028857 to 1026917)