Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1101417
End position: 1101440
Length: 24

DNA sequence
>NC_015671, from 1101417 to 1101440 (24 bp); Cellvibrio gilvus ATCC 13127 GACCGCGACCGCGACGGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1101067-1102635	Sequence	Celgi_1013 - hypothetical protein (Protein is coded in complementary strand; from 1102635 to 1101067)