Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1108765
End position: 1108788
Length: 24

DNA sequence
>NC_015671, from 1108765 to 1108788 (24 bp); Cellvibrio gilvus ATCC 13127 GGGGGTGGGAGGGTGGGGGGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1108786-1109598	Sequence	Celgi_1020 - short-chain dehydrogenase/reductase SDR