Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 116843
End position: 116866
Length: 24

DNA sequence
>NC_015671, from 116843 to 116866 (24 bp); Cellvibrio gilvus ATCC 13127 GTGGCCGTGGTCGTGGTCGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 115136-116935	Sequence	Celgi_0100 - TAP domain protein (Protein is coded in complementary strand; from 116935 to 115136)