Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1203366
End position: 1203389
Length: 24

DNA sequence
>NC_015671, from 1203366 to 1203389 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGCTCGAGCTCGCGATCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1202771-1203511	Sequence	Celgi_1095 - 4-diphosphocytidyl-2C-methyl-D-erythritol synthase