Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1211309
End position: 1211332
Length: 24

DNA sequence
>NC_015671, from 1211309 to 1211332 (24 bp); Cellvibrio gilvus ATCC 13127 AGATGAAGCTGAAGATGAAGATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1210762-1211631	Sequence	Celgi_1103 - ABC-2 type transporter (Protein is coded in complementary strand; from 1211631 to 1210762)