Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1252306
End position: 1252329
Length: 24

DNA sequence
>NC_015671, from 1252306 to 1252329 (24 bp); Cellvibrio gilvus ATCC 13127 ACGTCGACATCGACGACGACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1251139-1252827	Sequence	Celgi_1133 - integral membrane sensor signal transduction histidine kinase