Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1290313
End position: 1290336
Length: 24

DNA sequence
>NC_015671, from 1290313 to 1290336 (24 bp); Cellvibrio gilvus ATCC 13127 CCACGGCCACGCCCGCGGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1289124-1290917	Sequence	Celgi_1171 - GAF sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1290917 to 1289124)