Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1318708
End position: 1318731
Length: 24

DNA sequence
>NC_015671, from 1318708 to 1318731 (24 bp); Cellvibrio gilvus ATCC 13127 GGCGGCGGGGGCGGCGGTGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1318592-1320241	Sequence	Celgi_1197 - extracellular solute-binding protein family 5