Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1338130
End position: 1338153
Length: 24

DNA sequence
>NC_015671, from 1338130 to 1338153 (24 bp); Cellvibrio gilvus ATCC 13127 GTCGGGGCCGGGGCCGGGGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1336568-1338397	Sequence	Celgi_1210 - hypothetical protein (Protein is coded in complementary strand; from 1338397 to 1336568)