Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1416499
End position: 1416522
Length: 24

DNA sequence
>NC_015671, from 1416499 to 1416522 (24 bp); Cellvibrio gilvus ATCC 13127 CGACGTCGACGGCTACGTCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1416486-1417763	Sequence	Celgi_1271 - deoxyguanosinetriphosphate triphosphohydrolase