Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1453713
End position: 1453736
Length: 24

DNA sequence
>NC_015671, from 1453713 to 1453736 (24 bp); Cellvibrio gilvus ATCC 13127 CCTGACCCTGACCCTGACCCTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1453439-1454644	Sequence	Celgi_1313 - hypothetical protein (Protein is coded in complementary strand; from 1454644 to 1453439)