Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1640444
End position: 1640467
Length: 24

DNA sequence
>NC_015671, from 1640444 to 1640467 (24 bp); Cellvibrio gilvus ATCC 13127 GCCGCGTCCGCGACCGCGGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1640186-1643632	Sequence	Celgi_1500 - aldehyde dehydrogenase (Protein is coded in complementary strand; from 1643632 to 1640186)