Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1702103
End position: 1702126
Length: 24

DNA sequence
>NC_015671, from 1702103 to 1702126 (24 bp); Cellvibrio gilvus ATCC 13127 GGGCGCGGGGACGCGGGCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1701180-1702235	Sequence	Celgi_1560 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 1702235 to 1701180)