Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1756461
End position: 1756484
Length: 24

DNA sequence
>NC_015671, from 1756461 to 1756484 (24 bp); Cellvibrio gilvus ATCC 13127 TCCTCGGCCTCGGCCTCGGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1756449-1757408	Sequence	Celgi_1614 - ABC transporter related protein (Protein is coded in complementary strand; from 1757408 to 1756449)