Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1765948
End position: 1765971
Length: 24

DNA sequence
>NC_015671, from 1765948 to 1765971 (24 bp); Cellvibrio gilvus ATCC 13127 GTCGCGCTCGCGTTCGCGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1764677-1766335	Sequence	Celgi_1621 - SSS sodium solute transporter superfamily