Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1973647
End position: 1973670
Length: 24

DNA sequence
>NC_015671, from 1973647 to 1973670 (24 bp); Cellvibrio gilvus ATCC 13127 GACGCCCACGCCGACGCAGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1973468-1974319	Sequence	Celgi_1819 - tryptophan synthase, alpha subunit (Protein is coded in complementary strand; from 1974319 to 1973468)