Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 1982904
End position: 1982927
Length: 24

DNA sequence
>NC_015671, from 1982904 to 1982927 (24 bp); Cellvibrio gilvus ATCC 13127 CGACCACGATCACGACCGCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1981928-1983751	Sequence	Celgi_1829 - ABC transporter related protein (Protein is coded in complementary strand; from 1983751 to 1981928)