Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2099311
End position: 2099334
Length: 24

DNA sequence
>NC_015671, from 2099311 to 2099334 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGAGCGCGACCTCGAGCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2098961-2100694	Sequence	Celgi_1937 - DNA repair protein RecN (Protein is coded in complementary strand; from 2100694 to 2098961)