Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2168839
End position: 2168862
Length: 24

DNA sequence
>NC_015671, from 2168839 to 2168862 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGCCCGCGACCGCGACCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2167760-2170444	Sequence	Celgi_1994 - UDP-N-acetylmuramate/alanine ligase (Protein is coded in complementary strand; from 2170444 to 2167760)