Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2212966
End position: 2212989
Length: 24

DNA sequence
>NC_015671, from 2212966 to 2212989 (24 bp); Cellvibrio gilvus ATCC 13127 AGCGCGATCGCGAGCTCGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2212087-2213046	Sequence	Celgi_2030 - tRNA delta(2)-isopentenylpyrophosphate transferase (Protein is coded in complementary strand; from 2213046 to 2212087)