Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2232878
End position: 2232901
Length: 24

DNA sequence
>NC_015671, from 2232878 to 2232901 (24 bp); Cellvibrio gilvus ATCC 13127 GCGCGACCGCGAGCGCGTGCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2232031-2234199	Sequence	Celgi_2048 - type I phosphodiesterase/nucleotide pyrophosphatase (Protein is coded in complementary strand; from 2234199 to 2232031)