Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2269843
End position: 2269866
Length: 24

DNA sequence
>NC_015671, from 2269843 to 2269866 (24 bp); Cellvibrio gilvus ATCC 13127 GAACGTGAACGTGGACGTGAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2267087-2270725	Sequence	Celgi_2074 - glycoside hydrolase 9 (Protein is coded in complementary strand; from 2270725 to 2267087)