Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2357884
End position: 2357907
Length: 24

DNA sequence
>NC_015671, from 2357884 to 2357907 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGGGCGTGGGCGTGGGCGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2356865-2358085	Sequence	Celgi_2156 - glycoside hydrolase 3 domain protein (Protein is coded in complementary strand; from 2358085 to 2356865)