Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2440612
End position: 2440635
Length: 24

DNA sequence
>NC_015671, from 2440612 to 2440635 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGACCGCGTCCGCGAGCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2440274-2441077	Sequence	Celgi_2231 - ribonuclease PH (Protein is coded in complementary strand; from 2441077 to 2440274)