Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2454806
End position: 2454829
Length: 24

DNA sequence
>NC_015671, from 2454806 to 2454829 (24 bp); Cellvibrio gilvus ATCC 13127 GCCCGCGCCCACGCCCTCGCCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2454345-2455511	Sequence	Celgi_2246 - ROK family protein (Protein is coded in complementary strand; from 2455511 to 2454345)