Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2464288
End position: 2464311
Length: 24

DNA sequence
>NC_015671, from 2464288 to 2464311 (24 bp); Cellvibrio gilvus ATCC 13127 GTCGGCGTCGGGGTGGGCGTGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2463898-2465058	Sequence	Celgi_2254 - cellulose-binding family II (Protein is coded in complementary strand; from 2465058 to 2463898)