Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2487118
End position: 2487141
Length: 24

DNA sequence
>NC_015671, from 2487118 to 2487141 (24 bp); Cellvibrio gilvus ATCC 13127 ACGTCGACGCCGCCGTCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2486494-2487885	Sequence	Celgi_2268 - PDZ/DHR/GLGF domain protein (Protein is coded in complementary strand; from 2487885 to 2486494)