Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2538748
End position: 2538771
Length: 24

DNA sequence
>NC_015671, from 2538748 to 2538771 (24 bp); Cellvibrio gilvus ATCC 13127 GACGATGACCATGACCATGCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2537768-2538994	Sequence	Celgi_2312 - inner-membrane translocator (Protein is coded in complementary strand; from 2538994 to 2537768)