Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2594996
End position: 2595019
Length: 24

DNA sequence
>NC_015671, from 2594996 to 2595019 (24 bp); Cellvibrio gilvus ATCC 13127 CTCGCGCTCGAGCGCGCGCACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2594208-2595125	Sequence	Celgi_2366 - transcriptional regulator, LysR family (Protein is coded in complementary strand; from 2595125 to 2594208)