Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2596383
End position: 2596406
Length: 24

DNA sequence
>NC_015671, from 2596383 to 2596406 (24 bp); Cellvibrio gilvus ATCC 13127 CCCGCACCCGCACCCGTACCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2595244-2596515	Sequence	Celgi_2367 - C4-dicarboxylate transporter/malic acid transport protein
ORF... 2596407-2597141	Sequence	Celgi_2368 - glutamine amidotransferase (Protein is coded in complementary strand; from 2597141 to 2596407)