Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 268523
End position: 268546
Length: 24

DNA sequence
>NC_015671, from 268523 to 268546 (24 bp); Cellvibrio gilvus ATCC 13127 TCGTCGTCATCGTCGTCATCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 268223-268825	Sequence	Celgi_0234 - cadmium resistance transporter (Protein is coded in complementary strand; from 268825 to 268223)