Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2749576
End position: 2749599
Length: 24

DNA sequence
>NC_015671, from 2749576 to 2749599 (24 bp); Cellvibrio gilvus ATCC 13127 GCTCGAGCGCGAGCGCGAGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2748612-2749976	Sequence	Celgi_2481 - diaminopimelate decarboxylase (Protein is coded in complementary strand; from 2749976 to 2748612)