Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2761993
End position: 2762016
Length: 24

DNA sequence
>NC_015671, from 2761993 to 2762016 (24 bp); Cellvibrio gilvus ATCC 13127 CGCCGTCGCGGCGTCGCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2761377-2762765	Sequence	Celgi_2491 - drug resistance transporter, Bcr/CflA subfamily (Protein is coded in complementary strand; from 2762765 to 2761377)