Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2810682
End position: 2810705
Length: 24

DNA sequence
>NC_015671, from 2810682 to 2810705 (24 bp); Cellvibrio gilvus ATCC 13127 CAGCACCAGCATGAGCACCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2810629-2811900	Sequence	Celgi_2538 - putative integral membrane protein (Protein is coded in complementary strand; from 2811900 to 2810629)