Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2824193
End position: 2824216
Length: 24

DNA sequence
>NC_015671, from 2824193 to 2824216 (24 bp); Cellvibrio gilvus ATCC 13127 CGCGACCGCGTCCGCGAGCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2823915-2825429	Sequence	Celgi_2553 - alpha-L-arabinofuranosidase (Protein is coded in complementary strand; from 2825429 to 2823915)