Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2827459
End position: 2827482
Length: 24

DNA sequence
>NC_015671, from 2827459 to 2827482 (24 bp); Cellvibrio gilvus ATCC 13127 CGTCAAGGTCAACGTCATCGTCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2827266-2828621	Sequence	Celgi_2555 - extracellular solute-binding protein family 1