Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 284733
End position: 284756
Length: 24

DNA sequence
>NC_015671, from 284733 to 284756 (24 bp); Cellvibrio gilvus ATCC 13127 CCGACGCCGCCGCCGGCGCCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 284283-285197	Sequence	Celgi_0251 - alcohol dehydrogenase (Protein is coded in complementary strand; from 285197 to 284283)