Sequence retrieval

Genome: Cellvibrio gilvus ATCC 13127
Start position: 2874487
End position: 2874510
Length: 24

DNA sequence
>NC_015671, from 2874487 to 2874510 (24 bp); Cellvibrio gilvus ATCC 13127 GCCGTGCCCGTGACCGTGACCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2873719-2879895	Sequence	Celgi_2587 - Ig domain protein (Protein is coded in complementary strand; from 2879895 to 2873719)